ID: 958515909_958515912

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 958515909 958515912
Species Human (GRCh38) Human (GRCh38)
Location 3:95115501-95115523 3:95115529-95115551
Sequence CCAAATTATGACCAATCCTGTGA CTGTATACACATCTAAAACACGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!