ID: 958537653_958537662

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 958537653 958537662
Species Human (GRCh38) Human (GRCh38)
Location 3:95425067-95425089 3:95425109-95425131
Sequence CCCATATACCTGTGGCTTTGCAG CCCTTCCCTGGCTGCTTTCATGG
Strand - +
Off-target summary No data {0: 2, 1: 6, 2: 64, 3: 325, 4: 1030}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!