ID: 958586281_958586290

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 958586281 958586290
Species Human (GRCh38) Human (GRCh38)
Location 3:96091687-96091709 3:96091729-96091751
Sequence CCCAGTCAGGGGCTTATAGATAG AGAAGGGGCAGCTGTGGGCACGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 12, 3: 95, 4: 734}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!