ID: 958600692_958600707

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 958600692 958600707
Species Human (GRCh38) Human (GRCh38)
Location 3:96293230-96293252 3:96293274-96293296
Sequence CCTCAAATCCATTTCATTGAGGG TGGGATTTGTGAAGGGTGAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 5, 3: 47, 4: 534}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!