ID: 958634123_958634124

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 958634123 958634124
Species Human (GRCh38) Human (GRCh38)
Location 3:96720973-96720995 3:96720993-96721015
Sequence CCTGGCTTTAAGAGCTTAGATTC TTCTATGAAATCTTCAGAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 206} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!