ID: 958735638_958735650

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 958735638 958735650
Species Human (GRCh38) Human (GRCh38)
Location 3:98006736-98006758 3:98006769-98006791
Sequence CCAGAATATTAATATCCAGAAGG TGGAGGGTGAGGAGGGCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 162} {0: 1, 1: 1, 2: 28, 3: 361, 4: 2427}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!