ID: 958781318_958781325

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 958781318 958781325
Species Human (GRCh38) Human (GRCh38)
Location 3:98546891-98546913 3:98546934-98546956
Sequence CCAAACTTTTTTTCCTATTTCCC TGCCTTAAAAATAATGAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 66, 4: 635} {0: 1, 1: 0, 2: 3, 3: 41, 4: 359}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!