ID: 958881000_958881010

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 958881000 958881010
Species Human (GRCh38) Human (GRCh38)
Location 3:99669832-99669854 3:99669851-99669873
Sequence CCATGGTGTGATCCCTGCTCTTT CTTTGAGGGGTGGGCTTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 54, 4: 467} {0: 1, 1: 0, 2: 0, 3: 37, 4: 433}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!