ID: 958921903_958921907

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 958921903 958921907
Species Human (GRCh38) Human (GRCh38)
Location 3:100116486-100116508 3:100116519-100116541
Sequence CCAACTCTGGAATTAGCCATATC CCTCCATCCATTATGGAAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 45, 4: 221} {0: 1, 1: 0, 2: 0, 3: 11, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!