ID: 958925272_958925275

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 958925272 958925275
Species Human (GRCh38) Human (GRCh38)
Location 3:100150224-100150246 3:100150253-100150275
Sequence CCTTGGGGCCAGGGTTTCTTTTG CTATAGTACCTAACACAGTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 240} {0: 1, 1: 0, 2: 2, 3: 27, 4: 415}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!