ID: 958959532_958959540

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 958959532 958959540
Species Human (GRCh38) Human (GRCh38)
Location 3:100495690-100495712 3:100495703-100495725
Sequence CCATCCAGGTCCTGCAGGTTGGG GCAGGTTGGGTGGGTAGGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 252} {0: 1, 1: 1, 2: 8, 3: 67, 4: 731}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!