ID: 959041960_959041968

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 959041960 959041968
Species Human (GRCh38) Human (GRCh38)
Location 3:101432104-101432126 3:101432149-101432171
Sequence CCATCTTAAGAGATTTCGGGCCT GGCCATACTCCTTGTGGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 63} {0: 1, 1: 3, 2: 14, 3: 50, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!