ID: 959056946_959056951

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 959056946 959056951
Species Human (GRCh38) Human (GRCh38)
Location 3:101576508-101576530 3:101576527-101576549
Sequence CCCACGGTGCGGCCACGGCGGCC GGCCAGTGGTCTTGGTGTGCTGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 2, 3: 9, 4: 67} {0: 4, 1: 1, 2: 7, 3: 20, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!