ID: 959085770_959085784

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 959085770 959085784
Species Human (GRCh38) Human (GRCh38)
Location 3:101849535-101849557 3:101849580-101849602
Sequence CCGCCGACAGCTCCCTGAGCCAG CGAGCCGGTGGCGCAGGTGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 215} {0: 1, 1: 0, 2: 0, 3: 5, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!