ID: 959110998_959111008

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 959110998 959111008
Species Human (GRCh38) Human (GRCh38)
Location 3:102123257-102123279 3:102123279-102123301
Sequence CCACAGAGTGTAGCCTTGTGCCT TGGGTCCATAGGGGTGGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 238} {0: 1, 1: 1, 2: 9, 3: 59, 4: 387}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!