ID: 959123356_959123358

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 959123356 959123358
Species Human (GRCh38) Human (GRCh38)
Location 3:102259663-102259685 3:102259715-102259737
Sequence CCAATCTCTTTTCAAATGGTGGC TTATTTAACCAGTTCTGTATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 184} {0: 1, 1: 0, 2: 7, 3: 48, 4: 284}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!