ID: 959128870_959128875

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 959128870 959128875
Species Human (GRCh38) Human (GRCh38)
Location 3:102326324-102326346 3:102326359-102326381
Sequence CCTTGTGGACCAGCCATAATAGA GGCTGGCTTGCTATAGAGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 79} {0: 1, 1: 0, 2: 0, 3: 7, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!