ID: 959132634_959132635

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 959132634 959132635
Species Human (GRCh38) Human (GRCh38)
Location 3:102376317-102376339 3:102376370-102376392
Sequence CCAGCAATCTTCTAAAAGTACAT TTTGAGCTAGATAAATGTTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 212} {0: 1, 1: 0, 2: 3, 3: 30, 4: 249}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!