ID: 959132921_959132926

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 959132921 959132926
Species Human (GRCh38) Human (GRCh38)
Location 3:102380357-102380379 3:102380399-102380421
Sequence CCTGTCCAGCTCTGGCTTCTTGT CTAGAAGCAAAAGTGGCAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 27, 4: 274} {0: 1, 1: 0, 2: 0, 3: 18, 4: 251}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!