ID: 959245562_959245569

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 959245562 959245569
Species Human (GRCh38) Human (GRCh38)
Location 3:103863168-103863190 3:103863210-103863232
Sequence CCAAACCATGAGAGCAGCTATGA CACAGGGATGGAGCTGCCCAAGG
Strand - +
Off-target summary No data {0: 32, 1: 253, 2: 494, 3: 817, 4: 1322}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!