ID: 959358966_959358974

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 959358966 959358974
Species Human (GRCh38) Human (GRCh38)
Location 3:105366799-105366821 3:105366813-105366835
Sequence CCACCTGCTTTGCGCTGCGTCCG CTGCGTCCGGGGAAGTGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 67} {0: 1, 1: 0, 2: 0, 3: 20, 4: 331}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!