ID: 959362761_959362762

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 959362761 959362762
Species Human (GRCh38) Human (GRCh38)
Location 3:105414882-105414904 3:105414902-105414924
Sequence CCATTGTTTAAGATATGTCTGCA GCAGAGAGTGAGTTTAAAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 232} {0: 1, 1: 0, 2: 0, 3: 16, 4: 206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!