ID: 959396610_959396618

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 959396610 959396618
Species Human (GRCh38) Human (GRCh38)
Location 3:105847600-105847622 3:105847636-105847658
Sequence CCACCTCAGTTGACTTTTTTTCC CAGTGTGTAGGAGGGGAAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 362} {0: 1, 1: 0, 2: 3, 3: 40, 4: 393}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!