ID: 959397605_959397611

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 959397605 959397611
Species Human (GRCh38) Human (GRCh38)
Location 3:105860637-105860659 3:105860689-105860711
Sequence CCTTCTTAATATTTCTTCTCCCT AATCCCTGCAGATTTTGCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 57, 4: 701} {0: 1, 1: 0, 2: 2, 3: 27, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!