ID: 959476245_959476249

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 959476245 959476249
Species Human (GRCh38) Human (GRCh38)
Location 3:106815491-106815513 3:106815537-106815559
Sequence CCAGATGCTGAGTCCCCTGTTAG TATTTTTTTCATAGAAGCTTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 53, 4: 567}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!