ID: 959527415_959527422

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 959527415 959527422
Species Human (GRCh38) Human (GRCh38)
Location 3:107392744-107392766 3:107392797-107392819
Sequence CCAGACTACTCCAGTTACTTTCT CCTCAATCCCATTTTTCACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 214} {0: 1, 1: 0, 2: 2, 3: 23, 4: 281}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!