ID: 959528393_959528395

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 959528393 959528395
Species Human (GRCh38) Human (GRCh38)
Location 3:107403352-107403374 3:107403378-107403400
Sequence CCAGTCTATGGCAGTTCATTGTA GCCCAAACAGACTAAGAAAAGGG
Strand - +
Off-target summary No data {0: 1, 1: 5, 2: 23, 3: 84, 4: 467}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!