ID: 959539863_959539882

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 959539863 959539882
Species Human (GRCh38) Human (GRCh38)
Location 3:107525222-107525244 3:107525268-107525290
Sequence CCGGAATGGCAGCGCCGGGCCGG GGCAGCGGAGGCAGAGGCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 77} {0: 1, 1: 7, 2: 26, 3: 275, 4: 2167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!