ID: 959591894_959591903

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 959591894 959591903
Species Human (GRCh38) Human (GRCh38)
Location 3:108090917-108090939 3:108090958-108090980
Sequence CCGCCGCGGGGTCGCCGCCGCCG GCAGCCGCCGCCGCCGTTACAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 79, 4: 410} {0: 1, 1: 0, 2: 4, 3: 58, 4: 295}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!