ID: 959650338_959650346

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 959650338 959650346
Species Human (GRCh38) Human (GRCh38)
Location 3:108744961-108744983 3:108745002-108745024
Sequence CCAGACATCCCGTGAGTCACAGG TGGTGATGATGTGCCCTGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 88} {0: 1, 1: 0, 2: 0, 3: 12, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!