ID: 959667833_959667842

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 959667833 959667842
Species Human (GRCh38) Human (GRCh38)
Location 3:108941516-108941538 3:108941559-108941581
Sequence CCCTCCTCCATTTCATTCCCCTG ATTAGTCCAGTTTTGCCCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 75, 4: 725} {0: 1, 1: 0, 2: 2, 3: 21, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!