ID: 959669836_959669839

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 959669836 959669839
Species Human (GRCh38) Human (GRCh38)
Location 3:108963986-108964008 3:108964005-108964027
Sequence CCAGTAATTCACAGGCAATGACA GACAGAATGGCCCACCACTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 188} {0: 1, 1: 0, 2: 1, 3: 6, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!