ID: 959702152_959702160

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 959702152 959702160
Species Human (GRCh38) Human (GRCh38)
Location 3:109308730-109308752 3:109308765-109308787
Sequence CCCATAAACTGTAAATTCTCCAC TGGGTTGTTGAAACTGTGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 226} {0: 1, 1: 0, 2: 0, 3: 37, 4: 215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!