ID: 959741994_959742005

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 959741994 959742005
Species Human (GRCh38) Human (GRCh38)
Location 3:109731133-109731155 3:109731175-109731197
Sequence CCTCCCACTGTGTCCCTCTCATG GCCACAACCTGAGATTTGAATGG
Strand - +
Off-target summary {0: 3, 1: 72, 2: 728, 3: 1442, 4: 3188} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!