ID: 959840440_959840444

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 959840440 959840444
Species Human (GRCh38) Human (GRCh38)
Location 3:110968815-110968837 3:110968833-110968855
Sequence CCTTCCTGCTTTTTGATTTACAA TACAATAGCTCTAACTTGGTGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 5, 3: 31, 4: 334} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!