ID: 959849820_959849831

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 959849820 959849831
Species Human (GRCh38) Human (GRCh38)
Location 3:111072381-111072403 3:111072401-111072423
Sequence CCGCTGCCCTCCCCCGCGGCCGC CGCGCGGGTCGCCGTGCGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 109, 4: 831} {0: 1, 1: 0, 2: 0, 3: 2, 4: 49}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!