|
Left Crispr |
Right Crispr |
| Crispr ID |
959856264 |
959856273 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:111162314-111162336
|
3:111162337-111162359
|
| Sequence |
CCCACATCATGGGAAGGACCTGG |
TGGGAGGTAACTGAATCATGGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 2, 2: 17, 3: 68, 4: 318} |
{0: 659, 1: 4140, 2: 7325, 3: 9722, 4: 10207} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|