ID: 959868577_959868583

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 959868577 959868583
Species Human (GRCh38) Human (GRCh38)
Location 3:111300353-111300375 3:111300401-111300423
Sequence CCACAATCACTGTGCTCTCCTTC GCATCACATGGCTGCTACCAAGG
Strand - +
Off-target summary {0: 4, 1: 37, 2: 96, 3: 184, 4: 595} {0: 1, 1: 0, 2: 5, 3: 45, 4: 354}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!