ID: 959868579_959868591

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 959868579 959868591
Species Human (GRCh38) Human (GRCh38)
Location 3:111300375-111300397 3:111300417-111300439
Sequence CCCCTAAGTGCACAAATTCTATC ACCAAGGGATGGGGGAAGGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 10, 3: 62, 4: 238} {0: 1, 1: 1, 2: 16, 3: 168, 4: 1629}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!