ID: 959868579_959868593

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 959868579 959868593
Species Human (GRCh38) Human (GRCh38)
Location 3:111300375-111300397 3:111300423-111300445
Sequence CCCCTAAGTGCACAAATTCTATC GGATGGGGGAAGGGTGGTGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 10, 3: 62, 4: 238} {0: 1, 1: 1, 2: 27, 3: 253, 4: 1785}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!