ID: 959868580_959868585

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 959868580 959868585
Species Human (GRCh38) Human (GRCh38)
Location 3:111300376-111300398 3:111300406-111300428
Sequence CCCTAAGTGCACAAATTCTATCT ACATGGCTGCTACCAAGGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 82, 4: 391} {0: 1, 1: 1, 2: 6, 3: 37, 4: 301}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!