|
Left Crispr |
Right Crispr |
| Crispr ID |
959873458 |
959873467 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:111354589-111354611
|
3:111354641-111354663
|
| Sequence |
CCACCAGAAGCTAGAAAGAGGCA |
CCCGGCTGATACCTTGATTTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 9, 1: 80, 2: 223, 3: 1006, 4: 1301} |
{0: 1, 1: 12, 2: 157, 3: 634, 4: 1523} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|