ID: 959879400_959879403

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 959879400 959879403
Species Human (GRCh38) Human (GRCh38)
Location 3:111425737-111425759 3:111425775-111425797
Sequence CCACACAATAATTCTGGGAGACT CAGTATTAGATCACTGAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 96, 2: 5063, 3: 5777, 4: 2560} {0: 1, 1: 2, 2: 6, 3: 17, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!