ID: 959879658_959879664

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 959879658 959879664
Species Human (GRCh38) Human (GRCh38)
Location 3:111429079-111429101 3:111429124-111429146
Sequence CCAGCTTTGGCTACAGAGGGTGC CTACATGTTTTTAAGTCTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 42, 4: 898} {0: 1, 1: 0, 2: 3, 3: 21, 4: 296}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!