ID: 959883307_959883309

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 959883307 959883309
Species Human (GRCh38) Human (GRCh38)
Location 3:111471755-111471777 3:111471786-111471808
Sequence CCTGTGTGTGTCTTTGCTGGTGA TGTTAAATACAGCACACCAGTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 90, 3: 1205, 4: 6091} {0: 1, 1: 0, 2: 16, 3: 132, 4: 763}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!