ID: 959898049_959898055

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 959898049 959898055
Species Human (GRCh38) Human (GRCh38)
Location 3:111627472-111627494 3:111627509-111627531
Sequence CCACCCATGTTCTATGGCCAACA TCCTGGGACAGAGTGCCCAGTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 3, 3: 19, 4: 122} {0: 1, 1: 5, 2: 30, 3: 137, 4: 692}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!