ID: 959900449_959900453

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 959900449 959900453
Species Human (GRCh38) Human (GRCh38)
Location 3:111654968-111654990 3:111655015-111655037
Sequence CCTCTCTATTCTGCATTTTCTCT GGCTGAATGGGAAGATGATCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 89, 4: 719} {0: 1, 1: 0, 2: 2, 3: 13, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!