ID: 959916631_959916643

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 959916631 959916643
Species Human (GRCh38) Human (GRCh38)
Location 3:111823818-111823840 3:111823870-111823892
Sequence CCTGACGTTCCTCACCAGCCCCC ATGTGTGAGGAGATGGTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 234} {0: 1, 1: 2, 2: 1, 3: 49, 4: 598}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!