ID: 959919628_959919629

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 959919628 959919629
Species Human (GRCh38) Human (GRCh38)
Location 3:111856620-111856642 3:111856652-111856674
Sequence CCTGAAGGGAGAAAGGTTGTCTC TGTGTAGTCAAGTGTATTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 277} {0: 1, 1: 0, 2: 1, 3: 16, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!