ID: 959922152_959922163

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 959922152 959922163
Species Human (GRCh38) Human (GRCh38)
Location 3:111880240-111880262 3:111880293-111880315
Sequence CCATAGGGTACCATAATGAGCCT GCAGAATTAGAGATATGTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 60} {0: 1, 1: 1, 2: 6, 3: 38, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!